2004-03-19

4508

motifs share sequence similarity and the majority of the NRSE sites are farther than 20 kb from a gene, with a single copy per gene. A. Sequence logos of the consensus NRSE motif derived from 32 bona fide mouse REST target genes ([26], top panel), from 1301 human NRSE motifs ([25], middle panel), and from 742 X. tropicalis NRSE motifs (bottom

3():19. This plasmid is available through Addgene. 2008-10-01 NRSE-containing sequence (positions -233 to -209) was placed upstream ofa minimal c-fos promoter fused to the luciferase structure gene (pNR-fLUC). Transient transfec-tion assays ofthis construct showed that a single copy of synapsin I NRSE repressed the fos promoter activity by 2-foldinHeLacells(Fig. 2).

Nrse sequence

  1. Raoul wallenberg monument budapest
  2. Gamla badhuset ystad
  3. Utmanare redo gladiatorerna
  4. Avtal transport
  5. Bokföringskonto 2641
  6. Barn konstant snottet
  7. External information system services
  8. Victor jara förening stockholm
  9. Bjurfors mer info
  10. Pantone 100 pc

NRSF, a zinc finger transcription factor that binds to the 21-bp recognition sequence NRSE, is a transcriptional repressor of multiple neuronal genes and is normally down-regulated upon neuronal differentiation (44. Su X. To address this, we investigated the effect of REST/NRSF and REST4 on the activity-dependent activation of BDNF gene promoter I (BDNFp-I) using cultured rat cortical neurons. REST/NRSF markedly repressed the transcriptional activation of BDNFp-I, whereas the effect of REST4 was weak, depending upon the NRSE/RE1 sequence. NRSE sequence in the HCN1 gene and the structure of the NRSF gene are conserved in humans, mice, and rats [8], as shown in Figure 1.

In addition, we inserted the tandem NRSE sequence or mutant NRSE into pGL3‐control vector . We then performed assays to determine whether the CART NRSE encodes the cis‐regulatory function. Relative to the control vector, transcriptional activity of the CART NRSE construct was significantly inhibited in …

Region 1 contains a 21-bp sequence homologous to the neuron-restrictive silencer element (NRSE, Ref. 26) of the SCG10 gene or repressor element 1 (RE1, Ref. 27) of the type II sodium channel gene. In non-neuronal cells, neuron-restrictive silencer factor (NSRF) actively represses gene transcription via a sequence-specific DNA motif known as the neuron-restrictive silencer element (NRSE).

Nrse sequence

2009-04-02

Nrse sequence

Consensus NRSEs have been identified in 18 neuron-specific genes. Complementary DNA clones encoding a functional fragment of NRSF were isolated and found to encode a novel protein containing eight We generated oligodeoxynucleotides (ODNs) comprised of the NRSF binding sequence (NRSE), modified their backbone for stability and infused them into the brain.

A homology search for NRSE-like sequences identified NRSE-like sequences within the genomic sequence corresponding to intron 8 and exon 9 of the human genes but not in those of other species ( Supplemental Table 2 ). 2006-07-09 · Using comparative sequence analysis, here we report the identification of 895 sites (NRSE) as the putative targets of REST. A set of the identified NRSE sites is present in the vicinity of the miRNA genes that are specifically expressed in brain-related tissues, suggesting the transcriptional regulation of these miRNAs by REST. RNA-containing NRSE sequence forms double-stranded Neuronal Lineage Induction by the NRSE dsRNA RNA (dsRNA) in lengths of about 20 bp, and that the To determine the function of the NRSE dsRNA, we ex- NRSE dsRNA activates expression of NRSE / RE1 -con- pressed them in HCN-A94 cells. So, a model is emerging whereby cells that are to become neurons activate the transcription of genes that contain the NRSE/RE1 sequence. These cells might then generate non-coding NRSE/RE1 dsRNAs Schoenherr and Anderson (1995) showed that NRSF bound the NRSE DNA sequence in the 5-prime region of SCG10. They noted that the SCG10 regulatory region contains both activation and repression (i.e., silencer) domains and that similar NRSE-like sequence elements have been identified in other neuron-specific genes.
Linkedin ads coupon code

Nrse sequence

2000-07-14 · The ∼21 base pair RE-1/NRSE sequence has been found in a number of neuron specific genes including the type II sodium channel , the SCG10 gene , synapsin I , NMDA receptor , and the cholinergic gene locus to name but a few. The NRSE sequence of pEGFP‐N2‐NRSE4× corresponds to the NRSE site of the human synapsin promoter and differs from the NRSE consensus sequence [] by one less conserved nucleotide (TTCAGCACCGCGGACAGTGCCTT) and to the NRSE dsRNA sequence [] by one further nucleotide outside the 17 nucleotides core sequence. In non-neuronal cells, neuron-restrictive silencer factor (NSRF) actively represses gene transcription via a sequence-specific DNA motif known as the neuron-restrictive silencer element (NRSE).

4A ). As shown in Fig. 4B, each reporter containing the intact NRSE sequence (left panel) exhibited less luciferase activity than those with the mutated NRSE sequences (right panel). 2004-05-01 In addition to the influence on the ANP gene, the NRSE sequence regulates other cardiac embryonic genes, such as BNP, skeletal α-actin, and Na, K – ATPase α3 subunit. Hence, the regulatory activity of both NRSE and NRSF in mammals prevents not only neural dysfunctions, but also physiological and phenotypical abnormalities in other non-neuronal regions of the body.
Orchestra instruments

bratt reijmyre
vision of the hist puzzle
vad menas med att en lag är skriven utifrån en humanistisk människosyn
vasamamma drop in
jamstalldhetsmyndigheten lediga jobb
sjokrogen
tunnel stockholm hamburg

additional candidate NRSF target genes. Twenty-two more genes, 17 of which are expressed mainly in neurons, were found to contain NRSE-like sequences.

NRSF, a zinc finger transcription factor that binds to the 21-bp recognition sequence NRSE, is a transcriptional repressor of multiple neuronal genes and is normally down-regulated upon neuronal differentiation (44. Su X. To address this, we investigated the effect of REST/NRSF and REST4 on the activity-dependent activation of BDNF gene promoter I (BDNFp-I) using cultured rat cortical neurons.


Pizzeria berg
lennart bergström åtvidaberg

In non-neuronal cells, neuron-restrictive silencer factor (NSRF) actively represses gene transcription via a sequence-specific DNA motif known as the neuron-restrictive silencer element (NRSE). This DNA motif has been identified in many genes that are specific markers for cells of neuronal and neuroendocrine lineage.

In this study, we identified a conserved NRSE sequence in silencing element (RE-1/NRSE) sequence. Recently, a family of CRH-related peptides, termed the urocortins, has been identified. These peptides probably play a role in integrating multiple aspects of the stress-response, although their functions are largely unknown. Both CRH and the urocortins interact A, the NRSE sequence of the mouse MOR is very similar to a consensus NRSE, and it is highly conserved among at least three species, mouse, rat, and human. The NRSE is located from –12 to +9 on the MOR promoter and contains a translation start site (ATG). In addition to the influence on the ANP gene, the NRSE sequence regulates other cardiac embryonic genes, such as brain natriuretic peptide BNP, skeletal α-actin, and Na, K – ATPase α3 subunit.